Journal: Journal of biotechnology

Article Title: Combinatorial optimization of CRISPR/Cas9 expression enables precision genome engineering in the methylotrophic yeast Pichia pastoris.

doi: 10.1016/j.jbiotec.2016.03.027

Figure Lengend Snippet: Fig. 1: Critical features for CAS9/gRNA expression affecting the genome editing efficiency. Implementing CRISPR/Cas9 in a given organism is reliant on a set of interdependent components. These features include the DNA sequence of CAS9, the type and position of the NLS for the nuclear import of Cas9, different gRNA sequences and target loci, the promoter for the expression of the gRNAs, the introduction of processing elements for RNA maturation (ribozymes) as well as transcriptional termination. Elements on the plasmid are not drawn to scale. Cas9 (blue) shown on the right side includes the gRNA (red) and the target DNA for cleavage (yellow). The illustration of the Cas9/gRNA complex was taken from the RCSB PDB (see acknowledgements).

Article Snippet: The Homo sapiens codon optimized CAS9 (HsCAS9) and the Streptococcus pyogenes CAS9 (SpCAS9) were amplified from the template vectors p414-TEF1p-Cas9-CYC1t and pMJ806 (both obtained from Addgene, Cambridge, MA, USA) using primer pairs spCas9_fw/spCas9-SV40_rv and hsCas9_fw/ hsCas9-SV40_rv respectively.

Techniques: Expressing, CRISPR, Sequencing, Plasmid Preparation

Journal: Journal of biotechnology

Article Title: Combinatorial optimization of CRISPR/Cas9 expression enables precision genome engineering in the methylotrophic yeast Pichia pastoris.

doi: 10.1016/j.jbiotec.2016.03.027

Figure Lengend Snippet: Fig. 2: High efficiency implementation of CAS9 and gRNA expression in P. pastoris.

Article Snippet: The Homo sapiens codon optimized CAS9 (HsCAS9) and the Streptococcus pyogenes CAS9 (SpCAS9) were amplified from the template vectors p414-TEF1p-Cas9-CYC1t and pMJ806 (both obtained from Addgene, Cambridge, MA, USA) using primer pairs spCas9_fw/spCas9-SV40_rv and hsCas9_fw/ hsCas9-SV40_rv respectively.

Techniques: Expressing

Journal: Journal of biotechnology

Article Title: Combinatorial optimization of CRISPR/Cas9 expression enables precision genome engineering in the methylotrophic yeast Pichia pastoris.

doi: 10.1016/j.jbiotec.2016.03.027

Figure Lengend Snippet: Fig. 4: The CRISPR/Cas9 system allows high efficiency targeting of various genes (A) and is suitable for multiplexing (B, C) in P. pastoris.

Article Snippet: The Homo sapiens codon optimized CAS9 (HsCAS9) and the Streptococcus pyogenes CAS9 (SpCAS9) were amplified from the template vectors p414-TEF1p-Cas9-CYC1t and pMJ806 (both obtained from Addgene, Cambridge, MA, USA) using primer pairs spCas9_fw/spCas9-SV40_rv and hsCas9_fw/ hsCas9-SV40_rv respectively.

Techniques: CRISPR, Multiplexing

Journal: Nature protocols

Article Title: Large-scale reconstruction of cell lineages using single-cell readout of transcriptomes and CRISPRCas9 barcodes by scGESTALT

doi: 10.1038/s41596-018-0058-x

Figure Lengend Snippet: Left panels, During early and late developmental time periods, CRISPR-Cas9 induced indels record cell lineages as mutated genomic barcode sequences. Middle panels, Tissues of interest, such as brain, are dissociated into a single-cell suspension and loaded into a microfluidics device (inDrops). Single cells are encapsulated in droplets and indexed using hydrogels (color-coded to indicate different cell identifier primers) that are coated with oligodT primers. Polyadenylated cellular transcriptomes and scGESTALT lineage barcodes bind to the oligodT sequences and are simultaneously extracted from the same cells. Transcriptome libraries are sequenced to generate gene expression matrices for thousands of single cells. Gene expression profiles are used to perform dimensionality reduction using principal component analysis and visualized in two dimensions on a t-distributed stochastic neighbor embedding (t-SNE) plot. Single cells are represented as grey dots on the shown plot. A modularity-based clustering algorithm (Louvain) is used to cluster cells into discrete cell types using significant principal components. A t-SNE plot of 58,492 cells from n = 22 animals is color-coded to show 63 distinct clusters that were identified from zebrafish juvenile brains72. Right panels, scGESTALT libraries are sequenced to obtain lineage barcodes of profiled single cells. The inDrops index sequences are used to match transcriptomes and lineage barcodes for the same cells. Cell lineage trees are generated using maximum parsimony based on patterns of shared edits. Black and red nodes represent early and late barcode edits, respectively. Dashed lines connect profiled single cells to nodes on the tree. Cells connected to the same node are clonal (i.e. contain the same lineage barcode). Each cell is categorized into a discrete cell type (color coded rectangles) based on prior transcriptional clustering analysis. Brown shades represent forebrain cell types, blue shades represent midbrain cell types, green shades represent hindbrain cell types, and pink shades represent progenitor cell types. This procedure was approved by the HU/FAS Committee on the Use of Animals in Research & Teaching under Protocol No. 25–08. Figure adapted from ref72.

Article Snippet: Plasmids pCS2-zT2TP (available from Koichi Kawakami lab 78 ) pTol2-hspDRv7_scGstlt (Addgene, plasmid ID 108870) pTol2-hsp70l:Cas9-t2A-GFP, 5×U6:sgRNA (Addgene, plasmid ID 108871) DNA oligonucleotide sequences (purified by standard desalting, can be ordered from IDT) Name Sequence Purpose Step qPCRctrl F 5′-TCAGTCAACCATTCAGTGGCCCAT-3′ PCR amplify ultraconserved genomic region 23 qPCRctrl R 5′-CAGGAAAGGGAATGCAGGGTTTGT-3′ PCR amplify ultraconserved genomic region 23 qPCRdsRed F 5′-GAGCGCGTGATGAACTTCGAGG-3′ PCR amplify dsRed transgenic region 23 qPCRdsRed R 5′-CAGCCCATAGTCTTCTTCTGCATTACG-3′ PCR amplify dsRed transgenic region 23 sgRNAl 5′TTCTAATACGACTCACTATAGACAGCAGTATCATCGACTAGTTTTAGAGCTAGA-3′ Synthesize sgRNA1 for CRISPR-Cas9 lineage barcoding by injection 27 sgRNA2 5′-TTCTAATACGACTCACTATAGAGAGCGCGCTCGTCGACTAGTTTTAGAGCTAGA-3′ Synthesize sgRNA2 for CRISPR-Cas9 lineage barcoding by injection 27 sgRNA3 5′-TTCTAATACGACTCACTATAGTCAGCA GTACTACTGACGAGTTTTAGAGCTAGA-3′ Synthesize sgRNA3 for CRISPR-Cas9 lineage barcoding by injection 27 sgRNA4 5′-TTCTAATACGACTCACTATAGACAGCAGTGTGTGAGTCTAGTTTTAGAGCTAGA-3′ Synthesize sgRNA4 for CRISPR-Cas9 lineage barcoding by injection 27 scGESTALT F 5′-TCGAGCTCAAGCTTCGG-3′ PCR amplify scGESTALT fragment for assessing editing efficiency 43 scGESTALT R 5′-CTGCCATTTGTCTCGAGGTC-3′ PCR amplify scGESTALT fragment for assessing editing efficiency 43 inDrops_GP6 5′-GAGGACTACACCATCGTGGAG-3′ PCR amplify long scGESTALT fragment from inDrops library 90 inDrops_PE1Sa 5′-CTCTTTCCCTACACGACGCTGGGTGTCGGGTGCAG-3′ PCR amplify long scGESTALT fragment from inDrops library 90 inDrops_GP12 5′-TCGTCGGCAGCGTCAGATGTGTATAA GAGACAG NNNNNNNNNTCGAGCTCAA GCTTCGGAC-3′, where N stands for a random base PCR amplify short scGESTALT fragment from inDrops library 93 inDrops_PE1Sb 5′-CTCTTTCCCTACACGACGCT-3′ PCR amplify short scGESTALT fragment from inDrops library 93 R1-PCRix 5′-AATGATACGGCGACCACCGAGATCTACACxrefTCGTCGGCAGCGTC-3′, where xref is an index sequence for multiplexing (see Supplementary Table 2 ) PCR amplify transcriptome or scGESTALT final sequencing library 97 R2-PCR 5′-CAAGCAGAAGACGGCATACGAGATGGGTGTCGGGTGCAG-3′ PCR amplify transcriptome or scGESTALT final sequencing library 97 Open in a separate window

Techniques: CRISPR, Expressing, Generated

Journal: Nature protocols

Article Title: Large-scale reconstruction of cell lineages using single-cell readout of transcriptomes and CRISPRCas9 barcodes by scGESTALT

doi: 10.1038/s41596-018-0058-x

Figure Lengend Snippet: An example of a reconstructed lineage tree from a single juvenile zebrafish brain. 376 edited barcodes were recovered from single cells using inDrops. A cell lineage tree was generated from the barcodes based on shared edits using a maximum parsimony approach. Black nodes represent early barcode edits (Cas9 and sgRNA injection at 1-cell stage, Step 35); red nodes represent late edits (heat shock-induced Cas9 transgene expression, Step 38). Dashed lines join single cells to terminal nodes (represent the final edited barcode sequence) on the tree. Distinct cell types (identified from simultaneous transcriptome capture and cell clustering analyses) are color coded as indicated in the legend. The edited barcode for each cell is shown as a white bar with deletions (red) and insertions (blue). Examples of clades and subclades are indicated on the tree. A clade on the tree represents all lineage barcodes that share at least one common edit, and sub-clades that branch from the original clade contain increasingly restricted subsets of barcodes that contain the previous edit(s) as well as additional shared edits. Adapted with permission from ref72. This procedure was approved by the HU/FAS Committee on the Use of Animals in Research & Teaching under Protocol No. 25–08.

Article Snippet: Plasmids pCS2-zT2TP (available from Koichi Kawakami lab 78 ) pTol2-hspDRv7_scGstlt (Addgene, plasmid ID 108870) pTol2-hsp70l:Cas9-t2A-GFP, 5×U6:sgRNA (Addgene, plasmid ID 108871) DNA oligonucleotide sequences (purified by standard desalting, can be ordered from IDT) Name Sequence Purpose Step qPCRctrl F 5′-TCAGTCAACCATTCAGTGGCCCAT-3′ PCR amplify ultraconserved genomic region 23 qPCRctrl R 5′-CAGGAAAGGGAATGCAGGGTTTGT-3′ PCR amplify ultraconserved genomic region 23 qPCRdsRed F 5′-GAGCGCGTGATGAACTTCGAGG-3′ PCR amplify dsRed transgenic region 23 qPCRdsRed R 5′-CAGCCCATAGTCTTCTTCTGCATTACG-3′ PCR amplify dsRed transgenic region 23 sgRNAl 5′TTCTAATACGACTCACTATAGACAGCAGTATCATCGACTAGTTTTAGAGCTAGA-3′ Synthesize sgRNA1 for CRISPR-Cas9 lineage barcoding by injection 27 sgRNA2 5′-TTCTAATACGACTCACTATAGAGAGCGCGCTCGTCGACTAGTTTTAGAGCTAGA-3′ Synthesize sgRNA2 for CRISPR-Cas9 lineage barcoding by injection 27 sgRNA3 5′-TTCTAATACGACTCACTATAGTCAGCA GTACTACTGACGAGTTTTAGAGCTAGA-3′ Synthesize sgRNA3 for CRISPR-Cas9 lineage barcoding by injection 27 sgRNA4 5′-TTCTAATACGACTCACTATAGACAGCAGTGTGTGAGTCTAGTTTTAGAGCTAGA-3′ Synthesize sgRNA4 for CRISPR-Cas9 lineage barcoding by injection 27 scGESTALT F 5′-TCGAGCTCAAGCTTCGG-3′ PCR amplify scGESTALT fragment for assessing editing efficiency 43 scGESTALT R 5′-CTGCCATTTGTCTCGAGGTC-3′ PCR amplify scGESTALT fragment for assessing editing efficiency 43 inDrops_GP6 5′-GAGGACTACACCATCGTGGAG-3′ PCR amplify long scGESTALT fragment from inDrops library 90 inDrops_PE1Sa 5′-CTCTTTCCCTACACGACGCTGGGTGTCGGGTGCAG-3′ PCR amplify long scGESTALT fragment from inDrops library 90 inDrops_GP12 5′-TCGTCGGCAGCGTCAGATGTGTATAA GAGACAG NNNNNNNNNTCGAGCTCAA GCTTCGGAC-3′, where N stands for a random base PCR amplify short scGESTALT fragment from inDrops library 93 inDrops_PE1Sb 5′-CTCTTTCCCTACACGACGCT-3′ PCR amplify short scGESTALT fragment from inDrops library 93 R1-PCRix 5′-AATGATACGGCGACCACCGAGATCTACACxrefTCGTCGGCAGCGTC-3′, where xref is an index sequence for multiplexing (see Supplementary Table 2 ) PCR amplify transcriptome or scGESTALT final sequencing library 97 R2-PCR 5′-CAAGCAGAAGACGGCATACGAGATGGGTGTCGGGTGCAG-3′ PCR amplify transcriptome or scGESTALT final sequencing library 97 Open in a separate window

Techniques: Generated, Injection, Expressing, Sequencing

Journal: Nature protocols

Article Title: Large-scale reconstruction of cell lineages using single-cell readout of transcriptomes and CRISPRCas9 barcodes by scGESTALT

doi: 10.1038/s41596-018-0058-x

Figure Lengend Snippet: Zebrafish with single-copy heat shock promoter-driven scGESTALT barcode (to promote ubiquitous barcode expression at stage of interest) are crossed to zebrafish that express heat shock-inducible Cas9 and U6-driven sgRNAs 5–9. The barcode is cloned downstream of the dsRed coding sequence and upstream of the SV40 polyadenylation sequence (pA). Resulting embryos are injected with Cas9 protein and sgRNAs 1–4 at the one-cell stage (blue bars; early editing). The embryos are screened for GFP positive heart transgenics (cmlc2 promoter drives heart-specific GFP expression) at 30 hpf to identify embryos containing the barcode transgene, and sorted embryos are heat shocked to induce transgenic Cas9 for a second round of editing (orange bars; late editing). The embryos are screened again for ubiquitous GFP expression (Cas9 is linked to GFP with a t2A self-cleaving peptide), which indicates successful Cas9 transgene induction. Double transgenic embryos are grown for downstream profiling, and heat shocked at time of interest (e.g. juvenile stage 23–25 dpf) to induce expression of the edited barcode array prior to scRNA-seq analysis. Protocol steps for each stage are indicated. Adapted with permission from ref72.

Article Snippet: Plasmids pCS2-zT2TP (available from Koichi Kawakami lab 78 ) pTol2-hspDRv7_scGstlt (Addgene, plasmid ID 108870) pTol2-hsp70l:Cas9-t2A-GFP, 5×U6:sgRNA (Addgene, plasmid ID 108871) DNA oligonucleotide sequences (purified by standard desalting, can be ordered from IDT) Name Sequence Purpose Step qPCRctrl F 5′-TCAGTCAACCATTCAGTGGCCCAT-3′ PCR amplify ultraconserved genomic region 23 qPCRctrl R 5′-CAGGAAAGGGAATGCAGGGTTTGT-3′ PCR amplify ultraconserved genomic region 23 qPCRdsRed F 5′-GAGCGCGTGATGAACTTCGAGG-3′ PCR amplify dsRed transgenic region 23 qPCRdsRed R 5′-CAGCCCATAGTCTTCTTCTGCATTACG-3′ PCR amplify dsRed transgenic region 23 sgRNAl 5′TTCTAATACGACTCACTATAGACAGCAGTATCATCGACTAGTTTTAGAGCTAGA-3′ Synthesize sgRNA1 for CRISPR-Cas9 lineage barcoding by injection 27 sgRNA2 5′-TTCTAATACGACTCACTATAGAGAGCGCGCTCGTCGACTAGTTTTAGAGCTAGA-3′ Synthesize sgRNA2 for CRISPR-Cas9 lineage barcoding by injection 27 sgRNA3 5′-TTCTAATACGACTCACTATAGTCAGCA GTACTACTGACGAGTTTTAGAGCTAGA-3′ Synthesize sgRNA3 for CRISPR-Cas9 lineage barcoding by injection 27 sgRNA4 5′-TTCTAATACGACTCACTATAGACAGCAGTGTGTGAGTCTAGTTTTAGAGCTAGA-3′ Synthesize sgRNA4 for CRISPR-Cas9 lineage barcoding by injection 27 scGESTALT F 5′-TCGAGCTCAAGCTTCGG-3′ PCR amplify scGESTALT fragment for assessing editing efficiency 43 scGESTALT R 5′-CTGCCATTTGTCTCGAGGTC-3′ PCR amplify scGESTALT fragment for assessing editing efficiency 43 inDrops_GP6 5′-GAGGACTACACCATCGTGGAG-3′ PCR amplify long scGESTALT fragment from inDrops library 90 inDrops_PE1Sa 5′-CTCTTTCCCTACACGACGCTGGGTGTCGGGTGCAG-3′ PCR amplify long scGESTALT fragment from inDrops library 90 inDrops_GP12 5′-TCGTCGGCAGCGTCAGATGTGTATAA GAGACAG NNNNNNNNNTCGAGCTCAA GCTTCGGAC-3′, where N stands for a random base PCR amplify short scGESTALT fragment from inDrops library 93 inDrops_PE1Sb 5′-CTCTTTCCCTACACGACGCT-3′ PCR amplify short scGESTALT fragment from inDrops library 93 R1-PCRix 5′-AATGATACGGCGACCACCGAGATCTACACxrefTCGTCGGCAGCGTC-3′, where xref is an index sequence for multiplexing (see Supplementary Table 2 ) PCR amplify transcriptome or scGESTALT final sequencing library 97 R2-PCR 5′-CAAGCAGAAGACGGCATACGAGATGGGTGTCGGGTGCAG-3′ PCR amplify transcriptome or scGESTALT final sequencing library 97 Open in a separate window

Techniques: Expressing, Clone Assay, Sequencing, Injection, Transgenic Assay

Journal: Nature protocols

Article Title: Large-scale reconstruction of cell lineages using single-cell readout of transcriptomes and CRISPRCas9 barcodes by scGESTALT

doi: 10.1038/s41596-018-0058-x

Figure Lengend Snippet: scGESTALT barcode zebrafish were crossed to zebrafish that express heat shock-inducible Cas9 and U6-driven sgRNAs 5–9. Resulting embryos were injected with Cas9 protein and sgRNAs 1–4 at the one-cell stage. Embryos were heat shocked at 30 hpf to induce transgenic Cas9 for a late round of editing. Double transgenic (scGESTALT+, hsp:Cas9+; lanes 2–8, n = 7 embryos) and single transgenic (scGESTALT+, hsp:Cas9−; lanes 9–12, n = 4 embryos) were identified by screening for GFP expression. The gel shows PCR results of amplifying the scGESTALT barcode (unedited = ~300 bp). Large smear patterns (120–250bp) are observed in early and late edited embryos (lanes 2–8), whereas embryos that were only mutated at sites 1–4 display less editing (lanes 9–12. The band at ~200 bp in lane 12 likely represents large deletion(s) between sites 1–4 that occurred early in development and was inherited by most cells. Note that samples with such dominant large deletions should not be used for downstream experiments and analyses as they are likely to have low barcode diversity). Sample in lane 11 was likely not efficiently injected. Lane 1 represents a control embryo, which was injected with Cas9 protein only (no sgRNAs 1–4, n = 1 embryo) and was not heat shocked. As expected, the barcode is not edited in this case. This procedure was approved by the HU/FAS Committee on the Use of Animals in Research & Teaching under Protocol No. 25–08.

Article Snippet: Plasmids pCS2-zT2TP (available from Koichi Kawakami lab 78 ) pTol2-hspDRv7_scGstlt (Addgene, plasmid ID 108870) pTol2-hsp70l:Cas9-t2A-GFP, 5×U6:sgRNA (Addgene, plasmid ID 108871) DNA oligonucleotide sequences (purified by standard desalting, can be ordered from IDT) Name Sequence Purpose Step qPCRctrl F 5′-TCAGTCAACCATTCAGTGGCCCAT-3′ PCR amplify ultraconserved genomic region 23 qPCRctrl R 5′-CAGGAAAGGGAATGCAGGGTTTGT-3′ PCR amplify ultraconserved genomic region 23 qPCRdsRed F 5′-GAGCGCGTGATGAACTTCGAGG-3′ PCR amplify dsRed transgenic region 23 qPCRdsRed R 5′-CAGCCCATAGTCTTCTTCTGCATTACG-3′ PCR amplify dsRed transgenic region 23 sgRNAl 5′TTCTAATACGACTCACTATAGACAGCAGTATCATCGACTAGTTTTAGAGCTAGA-3′ Synthesize sgRNA1 for CRISPR-Cas9 lineage barcoding by injection 27 sgRNA2 5′-TTCTAATACGACTCACTATAGAGAGCGCGCTCGTCGACTAGTTTTAGAGCTAGA-3′ Synthesize sgRNA2 for CRISPR-Cas9 lineage barcoding by injection 27 sgRNA3 5′-TTCTAATACGACTCACTATAGTCAGCA GTACTACTGACGAGTTTTAGAGCTAGA-3′ Synthesize sgRNA3 for CRISPR-Cas9 lineage barcoding by injection 27 sgRNA4 5′-TTCTAATACGACTCACTATAGACAGCAGTGTGTGAGTCTAGTTTTAGAGCTAGA-3′ Synthesize sgRNA4 for CRISPR-Cas9 lineage barcoding by injection 27 scGESTALT F 5′-TCGAGCTCAAGCTTCGG-3′ PCR amplify scGESTALT fragment for assessing editing efficiency 43 scGESTALT R 5′-CTGCCATTTGTCTCGAGGTC-3′ PCR amplify scGESTALT fragment for assessing editing efficiency 43 inDrops_GP6 5′-GAGGACTACACCATCGTGGAG-3′ PCR amplify long scGESTALT fragment from inDrops library 90 inDrops_PE1Sa 5′-CTCTTTCCCTACACGACGCTGGGTGTCGGGTGCAG-3′ PCR amplify long scGESTALT fragment from inDrops library 90 inDrops_GP12 5′-TCGTCGGCAGCGTCAGATGTGTATAA GAGACAG NNNNNNNNNTCGAGCTCAA GCTTCGGAC-3′, where N stands for a random base PCR amplify short scGESTALT fragment from inDrops library 93 inDrops_PE1Sb 5′-CTCTTTCCCTACACGACGCT-3′ PCR amplify short scGESTALT fragment from inDrops library 93 R1-PCRix 5′-AATGATACGGCGACCACCGAGATCTACACxrefTCGTCGGCAGCGTC-3′, where xref is an index sequence for multiplexing (see Supplementary Table 2 ) PCR amplify transcriptome or scGESTALT final sequencing library 97 R2-PCR 5′-CAAGCAGAAGACGGCATACGAGATGGGTGTCGGGTGCAG-3′ PCR amplify transcriptome or scGESTALT final sequencing library 97 Open in a separate window

Techniques: Injection, Transgenic Assay, Expressing

Journal: Nature protocols

Article Title: Large-scale reconstruction of cell lineages using single-cell readout of transcriptomes and CRISPRCas9 barcodes by scGESTALT

doi: 10.1038/s41596-018-0058-x

Figure Lengend Snippet:

Article Snippet: Plasmids pCS2-zT2TP (available from Koichi Kawakami lab 78 ) pTol2-hspDRv7_scGstlt (Addgene, plasmid ID 108870) pTol2-hsp70l:Cas9-t2A-GFP, 5×U6:sgRNA (Addgene, plasmid ID 108871) DNA oligonucleotide sequences (purified by standard desalting, can be ordered from IDT) Name Sequence Purpose Step qPCRctrl F 5′-TCAGTCAACCATTCAGTGGCCCAT-3′ PCR amplify ultraconserved genomic region 23 qPCRctrl R 5′-CAGGAAAGGGAATGCAGGGTTTGT-3′ PCR amplify ultraconserved genomic region 23 qPCRdsRed F 5′-GAGCGCGTGATGAACTTCGAGG-3′ PCR amplify dsRed transgenic region 23 qPCRdsRed R 5′-CAGCCCATAGTCTTCTTCTGCATTACG-3′ PCR amplify dsRed transgenic region 23 sgRNAl 5′TTCTAATACGACTCACTATAGACAGCAGTATCATCGACTAGTTTTAGAGCTAGA-3′ Synthesize sgRNA1 for CRISPR-Cas9 lineage barcoding by injection 27 sgRNA2 5′-TTCTAATACGACTCACTATAGAGAGCGCGCTCGTCGACTAGTTTTAGAGCTAGA-3′ Synthesize sgRNA2 for CRISPR-Cas9 lineage barcoding by injection 27 sgRNA3 5′-TTCTAATACGACTCACTATAGTCAGCA GTACTACTGACGAGTTTTAGAGCTAGA-3′ Synthesize sgRNA3 for CRISPR-Cas9 lineage barcoding by injection 27 sgRNA4 5′-TTCTAATACGACTCACTATAGACAGCAGTGTGTGAGTCTAGTTTTAGAGCTAGA-3′ Synthesize sgRNA4 for CRISPR-Cas9 lineage barcoding by injection 27 scGESTALT F 5′-TCGAGCTCAAGCTTCGG-3′ PCR amplify scGESTALT fragment for assessing editing efficiency 43 scGESTALT R 5′-CTGCCATTTGTCTCGAGGTC-3′ PCR amplify scGESTALT fragment for assessing editing efficiency 43 inDrops_GP6 5′-GAGGACTACACCATCGTGGAG-3′ PCR amplify long scGESTALT fragment from inDrops library 90 inDrops_PE1Sa 5′-CTCTTTCCCTACACGACGCTGGGTGTCGGGTGCAG-3′ PCR amplify long scGESTALT fragment from inDrops library 90 inDrops_GP12 5′-TCGTCGGCAGCGTCAGATGTGTATAA GAGACAG NNNNNNNNNTCGAGCTCAA GCTTCGGAC-3′, where N stands for a random base PCR amplify short scGESTALT fragment from inDrops library 93 inDrops_PE1Sb 5′-CTCTTTCCCTACACGACGCT-3′ PCR amplify short scGESTALT fragment from inDrops library 93 R1-PCRix 5′-AATGATACGGCGACCACCGAGATCTACACxrefTCGTCGGCAGCGTC-3′, where xref is an index sequence for multiplexing (see Supplementary Table 2 ) PCR amplify transcriptome or scGESTALT final sequencing library 97 R2-PCR 5′-CAAGCAGAAGACGGCATACGAGATGGGTGTCGGGTGCAG-3′ PCR amplify transcriptome or scGESTALT final sequencing library 97 Open in a separate window

Techniques: Sequencing, Transgenic Assay, CRISPR, Injection, Multiplexing

Journal: Nature protocols

Article Title: Large-scale reconstruction of cell lineages using single-cell readout of transcriptomes and CRISPRCas9 barcodes by scGESTALT

doi: 10.1038/s41596-018-0058-x

Figure Lengend Snippet:

Article Snippet: Plasmids pCS2-zT2TP (available from Koichi Kawakami lab 78 ) pTol2-hspDRv7_scGstlt (Addgene, plasmid ID 108870) pTol2-hsp70l:Cas9-t2A-GFP, 5×U6:sgRNA (Addgene, plasmid ID 108871) DNA oligonucleotide sequences (purified by standard desalting, can be ordered from IDT) Name Sequence Purpose Step qPCRctrl F 5′-TCAGTCAACCATTCAGTGGCCCAT-3′ PCR amplify ultraconserved genomic region 23 qPCRctrl R 5′-CAGGAAAGGGAATGCAGGGTTTGT-3′ PCR amplify ultraconserved genomic region 23 qPCRdsRed F 5′-GAGCGCGTGATGAACTTCGAGG-3′ PCR amplify dsRed transgenic region 23 qPCRdsRed R 5′-CAGCCCATAGTCTTCTTCTGCATTACG-3′ PCR amplify dsRed transgenic region 23 sgRNAl 5′TTCTAATACGACTCACTATAGACAGCAGTATCATCGACTAGTTTTAGAGCTAGA-3′ Synthesize sgRNA1 for CRISPR-Cas9 lineage barcoding by injection 27 sgRNA2 5′-TTCTAATACGACTCACTATAGAGAGCGCGCTCGTCGACTAGTTTTAGAGCTAGA-3′ Synthesize sgRNA2 for CRISPR-Cas9 lineage barcoding by injection 27 sgRNA3 5′-TTCTAATACGACTCACTATAGTCAGCA GTACTACTGACGAGTTTTAGAGCTAGA-3′ Synthesize sgRNA3 for CRISPR-Cas9 lineage barcoding by injection 27 sgRNA4 5′-TTCTAATACGACTCACTATAGACAGCAGTGTGTGAGTCTAGTTTTAGAGCTAGA-3′ Synthesize sgRNA4 for CRISPR-Cas9 lineage barcoding by injection 27 scGESTALT F 5′-TCGAGCTCAAGCTTCGG-3′ PCR amplify scGESTALT fragment for assessing editing efficiency 43 scGESTALT R 5′-CTGCCATTTGTCTCGAGGTC-3′ PCR amplify scGESTALT fragment for assessing editing efficiency 43 inDrops_GP6 5′-GAGGACTACACCATCGTGGAG-3′ PCR amplify long scGESTALT fragment from inDrops library 90 inDrops_PE1Sa 5′-CTCTTTCCCTACACGACGCTGGGTGTCGGGTGCAG-3′ PCR amplify long scGESTALT fragment from inDrops library 90 inDrops_GP12 5′-TCGTCGGCAGCGTCAGATGTGTATAA GAGACAG NNNNNNNNNTCGAGCTCAA GCTTCGGAC-3′, where N stands for a random base PCR amplify short scGESTALT fragment from inDrops library 93 inDrops_PE1Sb 5′-CTCTTTCCCTACACGACGCT-3′ PCR amplify short scGESTALT fragment from inDrops library 93 R1-PCRix 5′-AATGATACGGCGACCACCGAGATCTACACxrefTCGTCGGCAGCGTC-3′, where xref is an index sequence for multiplexing (see Supplementary Table 2 ) PCR amplify transcriptome or scGESTALT final sequencing library 97 R2-PCR 5′-CAAGCAGAAGACGGCATACGAGATGGGTGTCGGGTGCAG-3′ PCR amplify transcriptome or scGESTALT final sequencing library 97 Open in a separate window

Techniques: Concentration Assay, Plasmid Preparation

Journal: Nature protocols

Article Title: Large-scale reconstruction of cell lineages using single-cell readout of transcriptomes and CRISPRCas9 barcodes by scGESTALT

doi: 10.1038/s41596-018-0058-x

Figure Lengend Snippet:

Article Snippet: Plasmids pCS2-zT2TP (available from Koichi Kawakami lab 78 ) pTol2-hspDRv7_scGstlt (Addgene, plasmid ID 108870) pTol2-hsp70l:Cas9-t2A-GFP, 5×U6:sgRNA (Addgene, plasmid ID 108871) DNA oligonucleotide sequences (purified by standard desalting, can be ordered from IDT) Name Sequence Purpose Step qPCRctrl F 5′-TCAGTCAACCATTCAGTGGCCCAT-3′ PCR amplify ultraconserved genomic region 23 qPCRctrl R 5′-CAGGAAAGGGAATGCAGGGTTTGT-3′ PCR amplify ultraconserved genomic region 23 qPCRdsRed F 5′-GAGCGCGTGATGAACTTCGAGG-3′ PCR amplify dsRed transgenic region 23 qPCRdsRed R 5′-CAGCCCATAGTCTTCTTCTGCATTACG-3′ PCR amplify dsRed transgenic region 23 sgRNAl 5′TTCTAATACGACTCACTATAGACAGCAGTATCATCGACTAGTTTTAGAGCTAGA-3′ Synthesize sgRNA1 for CRISPR-Cas9 lineage barcoding by injection 27 sgRNA2 5′-TTCTAATACGACTCACTATAGAGAGCGCGCTCGTCGACTAGTTTTAGAGCTAGA-3′ Synthesize sgRNA2 for CRISPR-Cas9 lineage barcoding by injection 27 sgRNA3 5′-TTCTAATACGACTCACTATAGTCAGCA GTACTACTGACGAGTTTTAGAGCTAGA-3′ Synthesize sgRNA3 for CRISPR-Cas9 lineage barcoding by injection 27 sgRNA4 5′-TTCTAATACGACTCACTATAGACAGCAGTGTGTGAGTCTAGTTTTAGAGCTAGA-3′ Synthesize sgRNA4 for CRISPR-Cas9 lineage barcoding by injection 27 scGESTALT F 5′-TCGAGCTCAAGCTTCGG-3′ PCR amplify scGESTALT fragment for assessing editing efficiency 43 scGESTALT R 5′-CTGCCATTTGTCTCGAGGTC-3′ PCR amplify scGESTALT fragment for assessing editing efficiency 43 inDrops_GP6 5′-GAGGACTACACCATCGTGGAG-3′ PCR amplify long scGESTALT fragment from inDrops library 90 inDrops_PE1Sa 5′-CTCTTTCCCTACACGACGCTGGGTGTCGGGTGCAG-3′ PCR amplify long scGESTALT fragment from inDrops library 90 inDrops_GP12 5′-TCGTCGGCAGCGTCAGATGTGTATAA GAGACAG NNNNNNNNNTCGAGCTCAA GCTTCGGAC-3′, where N stands for a random base PCR amplify short scGESTALT fragment from inDrops library 93 inDrops_PE1Sb 5′-CTCTTTCCCTACACGACGCT-3′ PCR amplify short scGESTALT fragment from inDrops library 93 R1-PCRix 5′-AATGATACGGCGACCACCGAGATCTACACxrefTCGTCGGCAGCGTC-3′, where xref is an index sequence for multiplexing (see Supplementary Table 2 ) PCR amplify transcriptome or scGESTALT final sequencing library 97 R2-PCR 5′-CAAGCAGAAGACGGCATACGAGATGGGTGTCGGGTGCAG-3′ PCR amplify transcriptome or scGESTALT final sequencing library 97 Open in a separate window

Techniques: Concentration Assay

Journal: Frontiers in Plant Science

Article Title: Multiplexed Genome Editing via an RNA Polymerase II Promoter-Driven sgRNA Array in the Diatom Phaeodactylum tricornutum : Insights Into the Role of StLDP

doi: 10.3389/fpls.2021.784780

Figure Lengend Snippet: A schematic diagram for the assembly of Level-0 Universal Loop parts into Level-1 transcriptional units and the final assembly of a Level-2 CRISPR/Cas9 diatom episome in the pCA plasmid kit. (A) a pCA-Level-1_2-sgRNA array was assembled in a Level-1 Golden Gate reaction with the BsaI enzyme and T4 DNA ligase for 30 cycles by combining Level-0 parts and sgRNA fragments with indicated overhangs. (B) A pCA-Level-1_3-SpCas9-P2A- Sh Ble/ Bsr1 transcriptional unit was assembled in a Level-1 Golden Gate reaction with the BsaI enzyme and T4 DNA ligase for 25 cycles by combining Level-0 parts with indicated overhangs. Promoter-terminator combination used for the sgRNA array is not reused for Sp Cas9-P2A- Sh Ble/ Bsr1 in the same Level-2 episome.

Article Snippet: Similarly, for the E. coli -mediated delivery of the multiplexed CRISPR/Cas9 episome, NEB® Stable E. coli was transformed with pTA-Mob ( ) and the Level-2 diatom episome.

Techniques: CRISPR, Plasmid Preparation

Journal: Frontiers in Plant Science

Article Title: Multiplexed Genome Editing via an RNA Polymerase II Promoter-Driven sgRNA Array in the Diatom Phaeodactylum tricornutum : Insights Into the Role of StLDP

doi: 10.3389/fpls.2021.784780

Figure Lengend Snippet: Editing efficiency of two episome constructs with orthogonal RNA polymerase II promoters driving gRNA and Cas9 expression to detect deletions in the StLDP gene.

Article Snippet: Similarly, for the E. coli -mediated delivery of the multiplexed CRISPR/Cas9 episome, NEB® Stable E. coli was transformed with pTA-Mob ( ) and the Level-2 diatom episome.

Techniques: Construct, Expressing

Journal: Nature communications

Article Title: Exploiting induced pluripotent stem cell-derived macrophages to unravel host factors influencing Chlamydia trachomatis pathogenesis.

doi: 10.1038/ncomms15013

Figure Lengend Snippet: Figure 7 | C. trachomatis infection of human iPSdM CRISPR/Cas9 mutants. (a,c) Level of GFP-tagged C. trachomatis infection of human iPSdM CRISPR/ Cas9 mutants after 48 h. Results are the averages from three independent measurements±s.d. using the Cellomics CellInsight NXT. (b) Production of cytokines from the IRF5 / mutant. Results are the average from three biological replicates assessed using the Luminex Multiplex and shown as fold change relative to expression of each cytokine in KOLF2 parent iPSdMs. *Represent statistically significant different (Po0.05) between parent and mutants as determined using two-way ANOVA. Equal numbers of WT and mutant cells were seeded for each experiment.

Article Snippet: Human iPSCs were dissociated to single cells and nucleofected (Amaxa2b nucleofector, LONZA) with Cas9 coding plasmid (hCas9, Addgene 41815), sgRNA plasmid and donor plasmid.

Techniques: Infection, CRISPR, Mutagenesis, Luminex, Multiplex Assay, Expressing

Journal: Cell

Article Title: Engineered virus-like particles for efficient in vivo delivery of therapeutic proteins

doi: 10.1016/j.cell.2021.12.021

Figure Lengend Snippet: Engineering and characterization of v1 BE-VLPs and v2 BE-eVLPs, related to and (A) Validation of VLP production. Immunoblot analysis of proteins from purified BE-VLPs using anti-Cas9, anti-p30 and anti-VSV-G antibodies. (B) Adenine base editing efficiencies of v1 BE-VLPs at position A 7 of the BCL11A enhancer site in HEK293T cells. Values and error bars reflect mean ± SEM of n = 3 biological replicates. Data were fit to four-parameter logistic curves using nonlinear regression. (C) Schematic of an immature BE-VLP with ABE8e fused to the gag structural protein. Various MMLV protease cleavage sites were inserted between gag and ABE8e to determine the optimal cleavable sequence that promotes liberation of ABE8e from gag during proteolytic virion maturation. Arrows indicate the cleavage site. (D) Representative western blot evaluating cleaved ABE8e versus full-length gag–ABE8e in purified v2 BE-eVLP variants. (E) Densitometry-based quantification of the cleaved ABE8e fraction from western blots. Data are shown as individual data points and mean values ± SEM for n = 3 technical replicates.

Article Snippet: Mouse anti-Cas9 monoclonal antibody , Cell Signaling Technology , Cat#14697; RRID: AB_2750916.

Techniques: Biomarker Discovery, Western Blot, Purification, Sequencing

Journal: Cell

Article Title: Engineered virus-like particles for efficient in vivo delivery of therapeutic proteins

doi: 10.1016/j.cell.2021.12.021

Figure Lengend Snippet: Characterization of BE-eVLPs, related to Figure 3 (A) Representative negative-stain transmission electron micrograph (TEM) of v4 BE-eVLPs. Scale bar, 200 nm. (B and C) Protein content for v1, v2.4, v3.4, and v4 BE-eVLPs was measured by anti-Cas9 or anti-MLV(p30) ELISA. Data are shown as individual data points and mean values ± SEM for n = 3 technical replicates. (D) Comparison of editing efficiencies with particle number-normalized v1, v2.4, v3.4 and v4 BE-VLPs at the BCL11A enhancer site in HEK293T cells. Data are shown as mean values ± SEM for n = 3 biological replicates. (E) Cell viability after v4 BE-eVLP treatment of HEK293T cells and NIH 3T3 fibroblasts. Data are shown as mean values ± SEM for n = 3 biological replicates. (F) Indels frequencies generated by v1 Cas9-VLP and v4 Cas9-eVLPs at the EMX1 locus in HEK293T cells. Data are shown as mean values ± SEM for n = 3 biological replicates. Data were fit to four-parameter logistic curves using nonlinear regression. (G) Adenine base editing efficiencies of VSV-G-pseudotyped v4 BE-eVLPs in Neuro-2a cells or 3T3 fibroblasts. Data are shown as individual data points and mean values ± SEM for n = 3 biological replicates.

Article Snippet: Mouse anti-Cas9 monoclonal antibody , Cell Signaling Technology , Cat#14697; RRID: AB_2750916.

Techniques: Staining, Transmission Assay, Enzyme-linked Immunosorbent Assay, Comparison, Generated

Journal: Cell

Article Title: Engineered virus-like particles for efficient in vivo delivery of therapeutic proteins

doi: 10.1016/j.cell.2021.12.021

Figure Lengend Snippet: Characterization of BE-eVLPs (A) Quantification of BE molecules per eVLP by anti-Cas9 and anti-MLV (p30) ELISA. Values and error bars reflect mean ± SEM of n = 3 replicates. (B) Quantification of relative sgRNA abundance by RT-qPCR using sgRNA-specific primers, normalized relative to v1 sgRNA abundance. Values and error bars reflect mean ± SEM of n = 3 technical replicates. (C and D) Comparison of editing efficiencies with v1, v2.4, v3.4, and v4 BE-eVLPs at the BCL11A enhancer site in HEK293T cells (C) and at the Dnmt1 site in NIH 3T3 cells (D). Values and error bars reflect mean ± SEM of n = 3 biological replicates. Data were fitted to four-parameter logistic curves using nonlinear regression. (E) Adenine base editing efficiencies in HEK293T cells of either single v4 BE-eVLPs targeting the HEK2 or BCL11A enhancer loci separately, or multiplex v4 BE-eVLPs targeting both loci simultaneously. (F) Adenine base editing efficiencies of FuG-B2-pseudotyped v4 BE-eVLPs at the Dnmt1 locus in Neuro-2a cells or 3T3 fibroblasts. (G) Adenine base editing efficiencies at three on-target genomic loci and their corresponding Cas-dependent off-target sites in HEK293T cells treated with v4 BE-eVLPs or ABE8e plasmid. OT1, off-target site 1; OT2, off-target site 2; OT3, off-target site 3. (H) Cas-independent off-target editing frequencies at six off-target R-loops in HEK293T cells treated with v4 BE-eVLPs or ABE8e plasmid. OTRL, off-target R-loop. See also Figure S4 A for the experimental timeline and Figure S4 B for on-target editing controls. (I) Molecules of BE-encoding DNA per v4 BE-eVLP detected by qPCR of lysed eVLPs or lysis buffer only. (J) Amount of BE-encoding DNA detected by qPCR of lysate from HEK293T cells that were either treated with v4 BE-eVLPs or transfected with BE-encoding plasmids. (E–J) Data are shown as individual data points and mean ± SEM for n = 3 biological replicates.

Article Snippet: Mouse anti-Cas9 monoclonal antibody , Cell Signaling Technology , Cat#14697; RRID: AB_2750916.

Techniques: Enzyme-linked Immunosorbent Assay, Quantitative RT-PCR, Comparison, Multiplex Assay, Plasmid Preparation, Lysis, Transfection

Journal: Cell

Article Title: Engineered virus-like particles for efficient in vivo delivery of therapeutic proteins

doi: 10.1016/j.cell.2021.12.021

Figure Lengend Snippet:

Article Snippet: Mouse anti-Cas9 monoclonal antibody , Cell Signaling Technology , Cat#14697; RRID: AB_2750916.

Techniques: Virus, Recombinant, Transfection, SYBR Green Assay, DNA Extraction, Multiplex Assay, Purification, Gel Extraction, Plasmid Preparation, Enzyme-linked Immunosorbent Assay, Cell Isolation, Titration, Amplification, Sequencing, Software

Journal: Neuron

Article Title: CRISPR interference-based platform for multimodal genetic screens in human iPSC-derived neurons

doi: 10.1016/j.neuron.2019.07.014

Figure Lengend Snippet: (A) Construct pC13N-dCas9-BFP-KRAB for the expression of CRISPRi machinery from the CLYBL safe-harbor locus: catalytically dead Cas9 (dCas9) fused to blue fluorescent protein (BFP) and the KRAB domain, under the control of the constitutive CAG promoter.

Article Snippet: HiFi Cas9 Nuclease V3 (Integrated DNA Technologies #1081060), a custom sgRNA targeting the human CLYBL intragenic safe harbor locus (between exons 2 and 3) from Synthego (sequence ATGTTGGAAGGATGAGGAAA), and the following plasmids: pC13N-dCas9-BFP-KRAB, CLYBL-TO-hNGN2-BSD-mApple (Addgene #124229) and pCE-mp53DD ( Okita et al., 2013 )(Addgene #41856).

Techniques: Construct, Expressing, Control

Journal: Neuron

Article Title: CRISPR interference-based platform for multimodal genetic screens in human iPSC-derived neurons

doi: 10.1016/j.neuron.2019.07.014

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: HiFi Cas9 Nuclease V3 (Integrated DNA Technologies #1081060), a custom sgRNA targeting the human CLYBL intragenic safe harbor locus (between exons 2 and 3) from Synthego (sequence ATGTTGGAAGGATGAGGAAA), and the following plasmids: pC13N-dCas9-BFP-KRAB, CLYBL-TO-hNGN2-BSD-mApple (Addgene #124229) and pCE-mp53DD ( Okita et al., 2013 )(Addgene #41856).

Techniques: Recombinant, Transfection, Membrane, Knock-Out, Multiplex Assay, RNA HS Assay, Plasmid Preparation, Software

Journal: Molecular Cell

Article Title: RNA Helicase DDX1 Converts RNA G-Quadruplex Structures into R-Loops to Promote IgH Class Switch Recombination

doi: 10.1016/j.molcel.2018.04.001

Figure Lengend Snippet:

Article Snippet: Guide RNA/Cas9 expression vectors were electroporated into CH12 cells using Amaxa Cell Line Nucleofector Kit R (Lonza) and cells were cloned using serial dilution assays 72 hr after transfection.

Techniques: Purification, Enzyme-linked Immunosorbent Assay, Recombinant, Cell Isolation, Multiplex Assay, Plasmid Preparation, Software